Last chromosome in human genome sequenced

[Haydnseek]

A turning point in the story of humans has surely been reached with this announcement:

Last chromosome in human genome sequenced
By Patricia Reaney
May 17, 2006

Scientists have reached a landmark point in one of the world's most important scientific projects by sequencing the last chromosome in the Human Genome, the so-called "book of life."

Chromosome 1 contains nearly twice as many genes as the average chromosome and makes up eight percent of the human genetic code.

It is packed with 3,141 genes and linked to 350 illnesses including cancer, Alzheimer's and Parkinson's disease.

"This achievement effectively closes the book on an important volume of the Human Genome Project," said Dr Simon Gregory who headed the sequencing project at the Sanger Institute in England.

The project was started in 1990 to identify the genes and DNA sequences that provide a blueprint for human beings.

Chromosome 1 is the biggest and contains, per chromosome, the greatest number of genes.

"Therefore it is the region of the genome to which the greatest number of diseases have been localized," added Gregory, from Duke University in the United States.

The sequence of chromosome 1, which is published online by the journal Nature, took a team of 150 British and American scientists 10 years to complete.

Researchers around the world will be able to mine the data to improve diagnostics and treatments for cancers, autism, mental disorders and other illnesses.

FINAL CHAPTER

Chromosomes, which are found in the nucleus of a cell, are thread-like structures that contain genes which determine the characteristics of an individual.

The human genome has an estimated 20,000 to 25,000 genes. The sequencing of chromosome 1 has led to the identification of more than 1,000 new genes.

"We are moving into the next phase which will be working out what the genes do and how they interact," Gregory told Reuters.

The genetic map of chromosome 1 has already been used to identify a gene for a common form of cleft lip and palate. It will also improve understanding of what processes lead to genetic diversity in populations, according to Gregory.

Each chromosome is made up of a molecule of DNA in the shape of a double helix which is composed of four chemical bases represented by the letters A (adenine), T (thymine), G (guanine) and C (cytosine). The arrangement, or sequence, of the letters determines the cell's genetic code.

The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique.

SNPs contain clues about why some people are susceptible to diseases like cancer or malaria, the best way to diagnose and treat them and how they will respond to drugs.

Copyright © 2006 Reuters Limited.

http://news.yahoo.com/s/nm/20060517/ts_ ... omosome_dc

[jbuck919]

"This achievement effectively closes the book on an important volume of the Human Genome Project," said Dr Simon Gregory who headed the sequencing project at the Sanger Institute in England.

At last, reading material for my 16-hour trip back to the States.

[Corlyss_D]

"This achievement effectively closes the book on an important volume of the Human Genome Project," said Dr Simon Gregory who headed the sequencing project at the Sanger Institute in England.

At last, reading material for my 16-hour trip back to the States.

TGAAAACCCTGGGGGAAAAATTTTTGC . . . ad lib

[Haydnseek]

At last, reading material for my 16-hour trip back to the States.

You might give the very interesting books of Matt Ridley a try. He has been following the Project closely.

Genome: The Autobiography of a Species in 23 Chapters
The Agile Gene: How Nature Turns On Nurture (UK Title: Nature via Nurture: Genes, Experience, and What Makes Us Human)

http://www.mattridley.co.uk/

[Ralph]

I think I have one of those genomes.

[Agnes Selby]

I think I have one of those genomes.

----------------

Are you sure? Which one?

[Ralph]

I think I have one of those genomes.

----------------

Are you sure? Which one?

*****

The mutuated gene that makes me a lover of Dittersdorf's music.

[Agnes Selby]

I must have the same gene for I love his music too

[Ralph]

I must have the same gene for I love his music too

*****

Great!